API Reference


Reports


GET /v1/reports/<name>/?population=<population>

param type key required eg. description
path param name TRUE eye-color url-safe name of phenotype: list of phenotyes
query param population TRUE european currently only european is a valid value. other populations are not available at present.
Eg.
>>> import genomelink
>>> report = genomelink.Report.fetch(name='eye-color', population='european', token='GENOMELINKTEST001')
>>> report.summary['text']
> const genomeLink = require('genomelink-node');
> let report; genomeLink.Report.fetch({ name: 'eye-color', population: 'european', token: 'GENOMELINKTEST001' }).then(_report => report = _report);
> report.summary.text
$ curl -H "Authorization: Bearer GENOMELINKTEST001" "https://genomelink.io/v1/reports/eye-color?population=european"| jq '.summary.text'
{
  "summary": {
    "text": "Tend to not have brown eyes, slightly",
    "score": 1,
    "warnings": [
      "this is DEMO data because this user does not have genome data"
    ]
  },
  "phenotype": {
    "url_name": "eye-color",
    "display_name": "Eye color",
    "category": "trait"
  },
  "population": "european",
  "scores": [
    {
      "score": 0,
      "text": "Tend to not have brown eyes"
    },
    {
      "score": 1,
      "text": "Tend to not have brown eyes, slightly"
    },
    {
      "score": 2,
      "text": "Intermediate"
    },
    {
      "score": 3,
      "text": "Slight tendency for brown eyes"
    },
    {
      "score": 4,
      "text": "Stronger tendency for brown eyes"
    }
  ]
}

Response

key type nullable description
summary.text string TRUE summary description of interpreted phenotype of the genome
summary.score integer (min:0, max:4) TRUE summary score of interpreted phenotype of the genome
summary.warnings list of string TRUE (blank list)
  • this is DEMO data because this user does not have genome data
  • reliability is low
  • this phenotype is not available for FREE plan users
phenotype.url_name string url-safe name of the phenotype used in URI
phenotype.display_name string display name of the phenotype
phenotype.category string category of the phenotype
population string population of evidences
scores.<index>.text string description of each phenotype interpretation
scores.<index>.score integer (min:0, max:4) score of each phenotype interpretation
NOTE

If the requested user has no genome, DEMO data will be returned with this is DEMO data because this user does not have genome data in warnings.

NOTE

If the requested user is not a paying user and requested phenotype is not FREE, null summary data will be returned with this phenotype is not available for FREE plan users in warnings.

"summary": {
  "text": null,
  "score": null,
  "warnings": [
    "this phenotype is not available for FREE plan users"
  ]
}
NOTE

If the app is not permitted to incorporate disease items in production, null summary data will be returned with this phenotype is not available for this app in warnings.

"summary": {
  "text": null,
  "score": null,
  "warnings": [
    "this phenotype is not available for this app"
  ]
}

Genomes


GET /v1/genomes/sequence/?region=<chrom:start-end>

param type key required eg. description
query param region TRUE chr12:112241766-112241866

region from start to end on chrom as chrom:start-end

  • chrom: chromosomes of query region.
  • start: start position of query region.
  • end: end position of query region.

soft limit: max length of sequence = 100000

Eg.
$ curl -H "Authorization: Bearer GENOMELINKTEST001" "https://genomelink.io/v1/genomes/sequence?region=chr1:100000-100500"
"CACTAAGCACACAGAGAATAATGTCTAGAATCTGAGTGCCATGTTATCAAATTGTACTGAGACTCTTGCAGTCACACAGGCTGACATGTAAGCATCGCCATGCCTAGTACAGACTCTCCCTGCAGATGAAATTATATGGGATGCTAAATTATAATGAGAACAATGTTTGGTGAGCCAAAACTACAACAAGGGAAGCTAATTGGATGAATTTATAAAAATATGCCTCAGCCAAAATAGCTTAATTCACTCTCCCTTATCATAAGGATAATCTTGCCTAAAGGGACAGTAATATTAAAGACACTAGGAATAACCTCTGTACTTTGGACAGTAGACCTGCATAGCCCATTAGGCCTCAATGAAGTCTTATGCAAGACCAGAAGCCAATTTGCCATTTAAGGTGATTCTCCATGTTTCTGCTCTAACTGTGCTTCACAATACTCAAAACACTAAATCAGGATGTTTCCTGGAGTTCAGGGAGCTGTCCGTGTTACTGAGCAGTTC"

Response

type description
string genome sequence of user
NOTE

Human reference genome version GRCh37.p13 is used.

chroms of the human genome is following. Each chrom has max position, so start and end has to be smaller or equal than max start/end.

chrom min start/end max start/end
chr11249250621
chr21243199373
chr31198022430
chr41191154276
chr51180915260
chr61171115067
chr71159138663
chr81146364022
chr91141213431
chr101135534747
chr111135006516
chr121133851895
chr131115169878
chr141107349540
chr151102531392
chr16190354753
chr17181195210
chr18178077248
chr19159128983
chr20163025520
chr21148129895
chr22151304566
chrX1155270560
chrY159373566
chrM116569
NOTE

If the app is not permitted to incorporate genome data of users, demo genome data will be returned. If you want to release an app with genome data of users incorporated, please contact us.